| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.150718 |
| Chromosome: | chromosome 2 |
| Location: | 1957184 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g088050 | RPP30,XRP30 | Ribonuclease MRP subunit P30; (1 of 1) K03539 - ribonuclease P/MRP protein subunit RPP1 (RPP1, RPP30) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AATCGCACAGGCGCGGAGATCATTTCGTTA |
| Internal bar code: | GTTAGCACTTGATGATGCGGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 99 |
| LEAP-Seq percent confirming: | 99.7642 |
| LEAP-Seq n confirming: | 1692 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TGTACATTTGTGCATGGCCT |
| Suggested primer 2: | GATTCGGACACTGCCGTACT |