| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.150772 |
| Chromosome: | chromosome 9 |
| Location: | 1628617 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre09.g397250 | FAD5A | Palmitate delta-7 desaturase; (1 of 2) K00507 - stearoyl-CoA desaturase (delta-9 desaturase) (SCD, desC) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCTGCATGAAGAATGCTGGAATGAGTGGAA |
| Internal bar code: | GTTCGGTGCTCGGCTACGCTTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 123 |
| LEAP-Seq percent confirming: | 97.4093 |
| LEAP-Seq n confirming: | 188 |
| LEAP-Seq n nonconfirming: | 5 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TAATCCCGTAGGGTGTAGCG |
| Suggested primer 2: | GTCCTCAGAGAGCCAGGATG |