| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.150920 |
| Chromosome: | chromosome 1 |
| Location: | 5360964 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g037600 | (1 of 1) K12418 - fatty acid desaturase (delta-4 desaturase) [EC:1.14.19.-] (K12418) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGATGGCACAGCCCTCACCACTGTCCC |
| Internal bar code: | GGGTGTCTAACTCTGGCGGGGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 343 |
| LEAP-Seq percent confirming: | 70.922 |
| LEAP-Seq n confirming: | 200 |
| LEAP-Seq n nonconfirming: | 82 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCATCCACCTAGGCACTC |
| Suggested primer 2: | AAAATGTCAAACGGGTCAGC |