| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.151031 |
| Chromosome: | chromosome 17 |
| Location: | 1561190 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g707500 | TOC120,TOC159 | Translocon at the outer envelope membrane of chloroplasts, receptor subunit; (1 of 1) PF11886 - Translocase of chloroplast 159/132, membrane anchor domain (TOC159_MAD) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCCGGGGGTGGGGGGCGGGGGCCGGGGCGG |
| Internal bar code: | GCCGCCAGAGTGTAATTCGATA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 416 |
| LEAP-Seq percent confirming: | 87.5 |
| LEAP-Seq n confirming: | 49 |
| LEAP-Seq n nonconfirming: | 7 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCAGCAGCACACAAACACTT |
| Suggested primer 2: | GGAGTGCCCTACCACCACTA |