| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.151041 |
| Chromosome: | chromosome 13 |
| Location: | 4550820 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g603750 | KCA1 | (1 of 2) PTHR10027 - CALCIUM-ACTIVATED POTASSIUM CHANNEL ALPHA CHAIN; Six-transmembrane domain potassium channel alpha subunit | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | AGCTCAAGCCCTCAGCTACATAACTGCACT |
| Internal bar code: | CAAGGCTGAGTCGACGTCTCTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 521 |
| LEAP-Seq percent confirming: | 99.3881 |
| LEAP-Seq n confirming: | 2599 |
| LEAP-Seq n nonconfirming: | 16 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTCCACCTTCCAGCAAATGT |
| Suggested primer 2: | GTTCCAAGACTGGTTGGCAT |