| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.151239 |
| Chromosome: | chromosome 12 |
| Location: | 2674951 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre12.g504050 | LAG2 | Predicted protein related to longevity assurance protein; (1 of 5) 2.3.1.24 - Sphingosine N-acyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCGTCGTCCGCCGCGGCGGCAGATCTTGCG |
| Internal bar code: | GTGAGCCAGTGAACGCGTGGTA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 834 |
| LEAP-Seq percent confirming: | 96.6193 |
| LEAP-Seq n confirming: | 36696 |
| LEAP-Seq n nonconfirming: | 1284 |
| LEAP-Seq n unique pos: | 120 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTTTGTATCTGCGGCGTTC |
| Suggested primer 2: | GGTAGTGGCACGGAACTGAT |