| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.151245 |
| Chromosome: | chromosome 2 |
| Location: | 2795740 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre02.g094300 | FUO1 | (1 of 1) 1.5.5.1 - Electron-transferring-flavoprotein dehydrogenase / ETF-ubiquinone oxidoreductase; Electron transfer flavoprotein-ubiquinone oxidoreductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGGTCCGTTGCCACGCCCATTGTTCGCAA |
| Internal bar code: | GTGGCCCGGGTTGGAGTGTGTT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 412 |
| LEAP-Seq percent confirming: | 99.919 |
| LEAP-Seq n confirming: | 1233 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GATTTTGGGCACGTTTAGGA |
| Suggested primer 2: | GAGGATCGTTGTCGGAGGTA |