Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.151326 |
Chromosome: | chromosome 9 |
Location: | 3091369 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre09.g386900 | RAB18A,RABC1,RAB18 | Small Rab-related GTPase; (1 of 1) PTHR24073:SF579 - RAS-RELATED PROTEIN RABC2B | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGACAAGAAGAGCGTGGGCGTCACCATTTG |
Internal bar code: | TGGATCGGGGCCCCGGTACGCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 551 |
LEAP-Seq percent confirming: | 99.3771 |
LEAP-Seq n confirming: | 1755 |
LEAP-Seq n nonconfirming: | 11 |
LEAP-Seq n unique pos: | 10 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGAGACCACCTCCATAAGCA |
Suggested primer 2: | TGCAACACACACACATACCG |