| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.151444 |
| Chromosome: | chromosome 11 |
| Location: | 1182688 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467689 | PETC1,PETC | (1 of 1) K02636 - cytochrome b6-f complex iron-sulfur subunit (petC); Chloroplast cytochrome b6f Rieske iron-sulfur center subunit | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAGCAACAACGTACAAGCGACACGCCCAG |
| Internal bar code: | GGTCAACAGAATGGTTCCCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 920 |
| LEAP-Seq percent confirming: | 86.0806 |
| LEAP-Seq n confirming: | 705 |
| LEAP-Seq n nonconfirming: | 114 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AAGACTGCGTCTCCGACCTA |
| Suggested primer 2: | CGCTTTCTTTACTTGCAGGG |