| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.151461 |
| Chromosome: | chromosome 3 |
| Location: | 7705829 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g203600 | GDP6,GDPD6 | Glycerophosphoryl diester phosphodiesterase, probably a phospholipase C; (1 of 1) IPR000909//IPR017946//IPR030395 - Phosphatidylinositol-specific phospholipase C, X domain // PLC-like phosphodiesterase, TIM beta/alpha-barrel domain // Glycerophosphodiester phosphodiesterase domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCTGTAAAATGTAATTTGCCCGCGGTTGC |
| Internal bar code: | TGCGCGGACTCTCTCCCCCGGC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 489 |
| LEAP-Seq percent confirming: | 99.703 |
| LEAP-Seq n confirming: | 4364 |
| LEAP-Seq n nonconfirming: | 13 |
| LEAP-Seq n unique pos: | 9 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TCCTAACCACGACCACTTCC |
| Suggested primer 2: | GTGTTAACCCAACAATGCCC |