| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.151569 |
| Chromosome: | chromosome 17 |
| Location: | 2498156 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre17.g716101 | POLL1 | (1 of 1) PF10391 - Fingers domain of DNA polymerase lambda (DNA_pol_lambd_f); DNA polymerase lambda | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGGCGACCGGTGCGTACGTGCGTGCCGGGG |
| Internal bar code: | GCTCGGGCGTGTGCACGGTTGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 531 |
| LEAP-Seq percent confirming: | 80.1402 |
| LEAP-Seq n confirming: | 343 |
| LEAP-Seq n nonconfirming: | 85 |
| LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATTTCCATCTCGGACTGCAC |
| Suggested primer 2: | GAACATTACCAACATGGGGC |