Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.151607 |
Chromosome: | chromosome 3 |
Location: | 3944114 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre03.g171600 | XPP1,XPP | Exopolyphosphatase; (1 of 2) K03787 - 5'-nucleotidase (surE) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCAGGAACAGGGCGTTGAGGATGGGAGGA |
Internal bar code: | CACCTTTGCGTGAGACGGCGGC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 717 |
LEAP-Seq percent confirming: | 98.1279 |
LEAP-Seq n confirming: | 2516 |
LEAP-Seq n nonconfirming: | 48 |
LEAP-Seq n unique pos: | 15 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GGCTACACGAGCGATCTAGG |
Suggested primer 2: | ATTTCCTGACTCATGCCCAC |