| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.151665 |
| Chromosome: | chromosome 14 |
| Location: | 2210688 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g622850 | RAD51A,RAD51 | (1 of 1) K04482 - DNA repair protein RAD51 (RAD51); RAS associated with diabetes protein 51 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCTTCCGCCCGCAGCGCCTGTCGCAGAT |
| Internal bar code: | GTGGAACTGCGAGTGATTGAAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 20 |
| LEAP-Seq percent confirming: | 0.211149 |
| LEAP-Seq n confirming: | 10 |
| LEAP-Seq n nonconfirming: | 4726 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCTTGTAGGTGAGCAGAGGC |
| Suggested primer 2: | GTCGAAGTGACAGAAACGCA |