Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.151712 |
Chromosome: | chromosome 4 |
Location: | 4082811 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g233302 | (1 of 2) PTHR23132//PTHR23132:SF9 - D-ALANINE--D-ALANINE LIGASE // SUBFAMILY NOT NAMED | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ATACACTGCATGTCAGCACACGCTCCGTTC |
Internal bar code: | CCATGAATTCCCCGCTCCTTTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 384 |
LEAP-Seq percent confirming: | 99.8487 |
LEAP-Seq n confirming: | 1980 |
LEAP-Seq n nonconfirming: | 3 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GTTTCTCAATTCTCGCAGGC |
Suggested primer 2: | TGGAGTCCTTAGTCATGCCC |