| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.151730 |
| Chromosome: | chromosome 10 |
| Location: | 4049347 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g449250 | KAP1,FLA3 | Kinesin II Associated Protein 1; (1 of 1) PTHR15605:SF2 - KINESIN-ASSOCIATED PROTEIN 3 | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTAAAACTCGCCACCTCACCTTGTACGCC |
| Internal bar code: | CCGGGCGCCGGTCCTCGGGGAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 786 |
| LEAP-Seq percent confirming: | 95.2218 |
| LEAP-Seq n confirming: | 279 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATGCGTAGATGACCCTGACC |
| Suggested primer 2: | GCAACCTCAAGTTCGAGTCC |