| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.151746 |
| Chromosome: | chromosome 16 |
| Location: | 7170780 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g681238 | (1 of 1) K03650 - tRNA modification GTPase [EC:3.6.-.-] (mnmE, trmE, MSS1) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTTGACTGCTCCGCAGGCTGGCATTGAA |
| Internal bar code: | CCCTCTGTGCTGCGTGGGCCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 334 |
| LEAP-Seq percent confirming: | 69.2891 |
| LEAP-Seq n confirming: | 2193 |
| LEAP-Seq n nonconfirming: | 972 |
| LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTTTACTACCCAGGCACCCA |
| Suggested primer 2: | TGGCATCAGACTACTGCGTC |