| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.151748 |
| Chromosome: | chromosome 4 |
| Location: | 3362557 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g227400 | FRE1 | (1 of 2) 1.16.1.7 - Ferric-chelate reductase (NADH) / NADH:Fe(3+)-EDTA reductase; Ferric-chelate reductase/ oxidoreductase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTACTACCATGGCTTGTATACTGCTAACAC |
| Internal bar code: | CTTTACGCCTGCGCTGCTTCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1052 |
| LEAP-Seq percent confirming: | 99.242 |
| LEAP-Seq n confirming: | 1833 |
| LEAP-Seq n nonconfirming: | 14 |
| LEAP-Seq n unique pos: | 13 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGGACGGGACACTGTACCTA |
| Suggested primer 2: | AACTTCAATCCGGTCGTGTC |