| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.151890 |
| Chromosome: | chromosome 8 |
| Location: | 3909052 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g378250 | SMM32 | (1 of 1) 2.1.1.85 - Protein-histidine N-methyltransferase / Protein methylase IV; S-adenosyl-L-methionine-dependent methyltransferase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTTGGGGCGGGGACTCAGCCGGCTCATCTT |
| Internal bar code: | CGTGGGCCCAAACAGTTGTCAA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 11 |
| LEAP-Seq percent confirming: | 42.0875 |
| LEAP-Seq n confirming: | 250 |
| LEAP-Seq n nonconfirming: | 344 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGAGAGGAAGAGCAGGGTG |
| Suggested primer 2: | GGGTGGACATAGGGGTAGGT |