| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.151923 |
| Chromosome: | chromosome 16 |
| Location: | 3809755 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g689550 | PTK8 | Putative tyrosine kinase; (1 of 10) PTHR23257//PTHR23257:SF520 - SERINE-THREONINE PROTEIN KINASE // IP11267P | 3'UTR |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | ACTCTTTACTTATCCCACTTCCCCAACACA |
| Internal bar code: | GCAAGGTAGGGGGCTGGGAGAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1016 |
| LEAP-Seq percent confirming: | 91.6096 |
| LEAP-Seq n confirming: | 535 |
| LEAP-Seq n nonconfirming: | 49 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAATGAATGAAAGCAGGGGA |
| Suggested primer 2: | GCTTTTCAACACGGGATCAT |