| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.152091 |
| Chromosome: | chromosome 7 |
| Location: | 6116706 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g355650 | AMT1F,AMT6 | Ammonium transporter; (1 of 8) K03320 - ammonium transporter, Amt family (amt, AMT, MEP) | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTCCAAGTGCGGCTGCGGCTGTGGCTGTGG |
| Internal bar code: | CCTGGGGGCGAGTGGGGTTGCA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 0 |
| LEAP-Seq percent confirming: | 0.0 |
| LEAP-Seq n confirming: | 0 |
| LEAP-Seq n nonconfirming: | 70 |
| LEAP-Seq n unique pos: | 0 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CGGTACTTCAAACCCCTTCA |
| Suggested primer 2: | GACCACTCCGTTCTCCACAT |