Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.152107 |
Chromosome: | chromosome 5 |
Location: | 3007871 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g238374 | (1 of 1) K11975 - E3 ubiquitin-protein ligase RNF144 [EC:6.3.2.19] (RNF144) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTTGGGACACAGCCAAACCGCTGCAGCAGC |
Internal bar code: | ATGGGTCCGACGCCTCACTCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 613 |
LEAP-Seq percent confirming: | 87.1063 |
LEAP-Seq n confirming: | 40237 |
LEAP-Seq n nonconfirming: | 5956 |
LEAP-Seq n unique pos: | 83 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GAGCAGAGCCACCCGTAGT |
Suggested primer 2: | CATTTGTGACGTTGTGGGAG |