| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.152116 |
| Chromosome: | chromosome 4 |
| Location: | 2775635 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g223750 | (1 of 1) IPR000048//IPR009071//IPR027417 - IQ motif, EF-hand binding site // High mobility group box domain // P-loop containing nucleoside triphosphate hydrolase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGCAGGATTACGGCTACCGGCCCTCTGCTC |
| Internal bar code: | TAGTACGGGTGTATGATTTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 781 |
| LEAP-Seq percent confirming: | 99.7573 |
| LEAP-Seq n confirming: | 1233 |
| LEAP-Seq n nonconfirming: | 3 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACCTTCCCCCTACCTGCTT |
| Suggested primer 2: | AAGCAAAAGGCGGTAAGACA |