Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.152165 |
Chromosome: | chromosome 5 |
Location: | 1495881 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre05.g243802 | (1 of 11) PF07173 - Protein of unknown function (DUF1399) (DUF1399) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TGAAGCAATTGCTGCATTTGTGGTCTGGCC |
Internal bar code: | ACCCACGTCTAGCTATTGCCTG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 93 |
LEAP-Seq percent confirming: | 99.2034 |
LEAP-Seq n confirming: | 2117 |
LEAP-Seq n nonconfirming: | 17 |
LEAP-Seq n unique pos: | 6 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AAGTATCGAAAGCCCCCACT |
Suggested primer 2: | GTGGCTTGTGTGATTGGATG |