Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.152195 |
Chromosome: | chromosome 1 |
Location: | 2343703 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre01.g012850 | KCN8 | Voltage-gated potassium channel; (1 of 1) PTHR10217//PTHR10217:SF514 - VOLTAGE AND LIGAND GATED POTASSIUM CHANNEL // SUBFAMILY NOT NAMED | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTCCGCGCTGCCATCCGAAAGGATGCTC |
Internal bar code: | ATGAACGATACTTTTCTCCAGA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 904 |
LEAP-Seq percent confirming: | 98.5075 |
LEAP-Seq n confirming: | 66 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | ACTTGCGCGAAGTTTAAGGA |
Suggested primer 2: | CCTCTACCTTGACGACCCAA |