| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.152303 |
| Chromosome: | chromosome 7 |
| Location: | 751435 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g317850 | FBB10 | Flagellar and Basal Body 10; (1 of 1) IPR029582 - Basal body-orientation factor 1 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCCGGCCCCAACAGCCCCGACGCCCCCAT |
| Internal bar code: | GTACGGTCGGGGTTACCTGTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1079 |
| LEAP-Seq percent confirming: | 98.4549 |
| LEAP-Seq n confirming: | 1147 |
| LEAP-Seq n nonconfirming: | 18 |
| LEAP-Seq n unique pos: | 14 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAGTAAACTTGCGCATGAA |
| Suggested primer 2: | CATGTACGCATGGTTTCGTC |