| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.152325 |
| Chromosome: | chromosome 14 |
| Location: | 2283460 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g623300 | NCP1,NCPR1,NCR1 | NADPH--cytochrome P450 reductase-related protein; (1 of 1) 4.1.3.44 - tRNA 4-demethylwyosine synthase (AdoMet-dependent) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGGGCTCGGGAGGGGTTGTTGGAGTTAAA |
| Internal bar code: | GGCCTTAACCGGTTCTGGTGCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 579 |
| LEAP-Seq percent confirming: | 98.5765 |
| LEAP-Seq n confirming: | 277 |
| LEAP-Seq n nonconfirming: | 4 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAAGGGTGGGGTTACAGTCA |
| Suggested primer 2: | TTCTTTGCCTGAGCAAACCT |