Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.152328 |
Chromosome: | chromosome 4 |
Location: | 2767493 |
Confidence (%): | 73 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre04.g223700 | (1 of 2) K07735 - putative transcriptional regulator (algH) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGTAGCGTGGCGTGGCATGGCGTGGCGTG |
Internal bar code: | TTCTGATACACGGCGTGGGTAC |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 558 |
LEAP-Seq percent confirming: | 86.1133 |
LEAP-Seq n confirming: | 3237 |
LEAP-Seq n nonconfirming: | 522 |
LEAP-Seq n unique pos: | 16 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTGCGTGCAGGTAAATAGCA |
Suggested primer 2: | ACCCCATTCCTAATTTTGCC |