| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.152397 |
| Chromosome: | chromosome 4 |
| Location: | 3524279 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g228150 | FAE1 | (1 of 1) PF02797//PF08392//PF08541 - Chalcone and stilbene synthases, C-terminal domain (Chal_sti_synt_C) // FAE1/Type III polyketide synthase-like protein (FAE1_CUT1_RppA) // 3-Oxoacyl-[acyl-carrier-protein (ACP)] synthase III C terminal (ACP_syn_III_C); Putative beta-ketoacyl-coa synthase | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTGCCAGTGGTTCCAACGCACCCACTGCCT |
| Internal bar code: | GCATTACGGCTGGGCCGAAGTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 827 |
| LEAP-Seq percent confirming: | 92.2999 |
| LEAP-Seq n confirming: | 33635 |
| LEAP-Seq n nonconfirming: | 2806 |
| LEAP-Seq n unique pos: | 96 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ATCCCTACCCCCAAAGATTG |
| Suggested primer 2: | CACACCTGTCCTCACACACC |