| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.152495 |
| Chromosome: | chromosome 8 |
| Location: | 889480 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre08.g361400 | (1 of 3) PF03638 - Tesmin/TSO1-like CXC domain, cysteine-rich domain (TCR) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTCATCGCAAGCGCAAGACACACACAAGTA |
| Internal bar code: | TCGGTAGGATTTATCTGGCTGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 350 |
| LEAP-Seq percent confirming: | 66.5621 |
| LEAP-Seq n confirming: | 1698 |
| LEAP-Seq n nonconfirming: | 853 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTGTCAGTCACCCATGCAAC |
| Suggested primer 2: | ATTGCGCTGCAATACATGAC |