| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.152568 |
| Chromosome: | chromosome 11 |
| Location: | 331498 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre11.g467568 | (1 of 1) K06276 - 3-phosphoinositide dependent protein kinase-1 (PDPK1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTATTTTTAACTTGGCCGGACTGGCCAACG |
| Internal bar code: | CGATGGTGGTTGTGGCGATAAT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 324 |
| LEAP-Seq percent confirming: | 95.1351 |
| LEAP-Seq n confirming: | 176 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 1 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | ACCCTCCTTGTCCTGGATCT |
| Suggested primer 2: | AACACAGCAACAGCAACAGC |