| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.152639 |
| Chromosome: | chromosome 10 |
| Location: | 5755881 |
| Confidence (%): | 58 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g461050 | ATPvA1,ATPVA1 | Vacuolar ATP synthase subunit A; (1 of 1) K02145 - V-type H+-transporting ATPase subunit A (ATPeV1A, ATP6A) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCAACCATTCCTGTGGGGCTGGTCGCGT |
| Internal bar code: | GATTAACGTGATGAGTTCTGAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 563 |
| LEAP-Seq percent confirming: | 99.5455 |
| LEAP-Seq n confirming: | 438 |
| LEAP-Seq n nonconfirming: | 2 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CCCTCTACAAGCTGACCTCG |
| Suggested primer 2: | AAGAGGAAATGACACGGTCG |