| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.152812 |
| Chromosome: | chromosome 10 |
| Location: | 4586671 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre10.g452550 | HOPP1,HOP1 | Homologous-pairing protein 1; (1 of 3) PF02301 - HORMA domain (HORMA) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TTCTCATCCAGCCTACCCGATTCAAACCAC |
| Internal bar code: | GTTATCTCTTTGAGCACATTTG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 583 |
| LEAP-Seq percent confirming: | 99.1579 |
| LEAP-Seq n confirming: | 942 |
| LEAP-Seq n nonconfirming: | 8 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTGACTGCATGGATGTGGAC |
| Suggested primer 2: | TGTTGAGCAGTGAGGAGTGG |