| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.152813 |
| Chromosome: | chromosome 4 |
| Location: | 3293321 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre04.g226900 | (1 of 1) PTHR15441:SF1 - RIBONUCLEASE P PROTEIN SUBUNIT P14 | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CATCCTGCACCACGCACATGGGGGGCGGCG |
| Internal bar code: | CGCGAGGTATGGCGTCCAGTCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 145 |
| LEAP-Seq percent confirming: | 87.9908 |
| LEAP-Seq n confirming: | 1905 |
| LEAP-Seq n nonconfirming: | 260 |
| LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TTTGGAGCTTCGGTTGAAAG |
| Suggested primer 2: | GTCTGAGCCAAGCACTTTCC |