| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.152839 |
| Chromosome: | chromosome 1 |
| Location: | 7710644 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre01.g055453 | ALS2,ALSS1 | Acetolactate synthase, small subunit; (1 of 1) K01653 - acetolactate synthase I/III small subunit (E2.2.1.6S, ilvH, ilvN) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTGACGCAACAGCATGAACTACGGAGGCAG |
| Internal bar code: | GAGAGGCAAAGGATGGCTTGGA |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 746 |
| LEAP-Seq percent confirming: | 99.8507 |
| LEAP-Seq n confirming: | 669 |
| LEAP-Seq n nonconfirming: | 1 |
| LEAP-Seq n unique pos: | 5 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGTGGTTCATTCATTTTGGG |
| Suggested primer 2: | CAGGAAGAGGTCAGGAGCAG |