Insertion junction: LMJ.RY0402.152884_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:-
Strain:LMJ.RY0402.152884
Chromosome:chromosome_16
Location:7720608
Confidence (%):58
Locus disrupted Locus common name Defline Orientation Feature
Cre16.g691440 FAP43 Flagellar Associated Protein sense CDS

Insertion site details

Flanking sequence (orientation from cassette outwards):ACGTCACACGCGACATGCAGGTGAGGCAGG
Internal bar code:GTTACGCTGTGCCCAGCGCAGG

Confirmation - LEAP-Seq

LEAP-Seq distance:647
LEAP-Seq percent confirming:97.548
LEAP-Seq n confirming:915
LEAP-Seq n nonconfirming:23
LEAP-Seq n unique pos:10

Suggested primers for confirmation by PCR

Suggested primer 1:ACAACCTGTCTGGCCTCAAG
Suggested primer 2:ACAGCCTTGGACCTTCCTTT