| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.152943 |
| Chromosome: | chromosome 13 |
| Location: | 4780427 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre13.g605050 | (1 of 1) K15075 - DNA repair/transcription protein MET18/MMS19 (MET18, MMS19) | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CTGAACCCCATTTCCTCTGCCAACCCACCT |
| Internal bar code: | ACGGGTCGACGGAGAATGGTCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 837 |
| LEAP-Seq percent confirming: | 86.5829 |
| LEAP-Seq n confirming: | 2962 |
| LEAP-Seq n nonconfirming: | 459 |
| LEAP-Seq n unique pos: | 29 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GTTGTCGATCGTCACACACC |
| Suggested primer 2: | GGTGGAACCAGACGCTGTAT |