Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.153085 |
Chromosome: | chromosome 2 |
Location: | 4841472 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g103200 | (1 of 7) PF00211//PF13416 - Adenylate and Guanylate cyclase catalytic domain (Guanylate_cyc) // Bacterial extracellular solute-binding protein (SBP_bac_8) | intron |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGCACCACAACTGTGGGTGGAGAAAGTGAA |
Internal bar code: | GTGGTTCCTGGAGAGTGCAGAA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 617 |
LEAP-Seq percent confirming: | 99.5902 |
LEAP-Seq n confirming: | 243 |
LEAP-Seq n nonconfirming: | 1 |
LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACCCTGGTACATGCCTGAG |
Suggested primer 2: | TGAACACGCTGAAGTTCCTG |