| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | + |
| Strain: | LMJ.RY0402.153125 |
| Chromosome: | chromosome 6 |
| Location: | 3768096 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre06.g278158 | (1 of 2) IPR001283//IPR003882//IPR014044 - Cysteine-rich secretory protein, allergen V5/Tpx-1-related // Pistil-specific extensin-like protein // CAP domain | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CACCGCAACCTCAGCAGGGCCCGTCGATCC |
| Internal bar code: | TTCGCACCGTATCCTGGGCTCCC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1106 |
| LEAP-Seq percent confirming: | 97.8947 |
| LEAP-Seq n confirming: | 279 |
| LEAP-Seq n nonconfirming: | 6 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTACCGTACGGCTACCGTGT |
| Suggested primer 2: | ACTGAACCTTTGAGGCGAGA |