| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | + |
| Strain: | LMJ.RY0402.153177 |
| Chromosome: | chromosome 3 |
| Location: | 1302846 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre03.g150350 | CPLD70 | Conserved in the Plant Lineage and Diatoms; (1 of 5) K14326 - regulator of nonsense transcripts 1 (UPF1, RENT1) | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACTCAATACTGGCGCAAACCGCGGGCCACG |
| Internal bar code: | CTGGACATTAGGCCACTAGCCG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 994 |
| LEAP-Seq percent confirming: | 97.5927 |
| LEAP-Seq n confirming: | 6527 |
| LEAP-Seq n nonconfirming: | 161 |
| LEAP-Seq n unique pos: | 44 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGCTTGAAGAGGAGGAGGC |
| Suggested primer 2: | ACAGAGCTCCTTGGGTGAGA |