| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.153187 |
| Chromosome: | chromosome 7 |
| Location: | 5433621 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre07.g350451 | (1 of 2) IPR001680//IPR017986//IPR020472//IPR027417 - WD40 repeat // WD40-repeat-containing domain // G-protein beta WD-40 repeat // P-loop containing nucleoside triphosphate hydrolase | CDS |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTGGGCGTGGCGGGGGTGCTCACGTCCCA |
| Internal bar code: | AGACCCGGGATCGAGTCCTGGG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 1017 |
| LEAP-Seq percent confirming: | 99.7041 |
| LEAP-Seq n confirming: | 3033 |
| LEAP-Seq n nonconfirming: | 9 |
| LEAP-Seq n unique pos: | 24 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GAGATTCAGGCCCTCCCTAC |
| Suggested primer 2: | GACACAGTAGATCGCAGGCA |