| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.153340 |
| Chromosome: | chromosome 16 |
| Location: | 3114077 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g665600 | CSK7 | (1 of 3) K03097 - casein kinase II subunit alpha (CSNK2A); Casein kinase II-related Ser/Thr kinase | 3'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | ACGTCGGGGGCTATGCACCCCGCCCTTGAG |
| Internal bar code: | GGAGGACGCTGACGCGGCGCTC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 991 |
| LEAP-Seq percent confirming: | 97.5597 |
| LEAP-Seq n confirming: | 1919 |
| LEAP-Seq n nonconfirming: | 48 |
| LEAP-Seq n unique pos: | 12 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | TACTGTTCAAGGGGCTCACC |
| Suggested primer 2: | CTGCGTTGATCTGTCAGGAA |