Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | - |
Strain: | LMJ.RY0402.153585 |
Chromosome: | chromosome 17 |
Location: | 4791806 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre17.g733800 | (1 of 139) IPR011011 - Zinc finger, FYVE/PHD-type | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CGTCCCAGTGGCGGCAGGACGCGTGCTTCA |
Internal bar code: | TCCTTTGTTGGCGCCTGGGATG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 1 |
LEAP-Seq percent confirming: | 99.4857 |
LEAP-Seq n confirming: | 2708 |
LEAP-Seq n nonconfirming: | 14 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AGCAGGAGAAACAGCAGGAG |
Suggested primer 2: | GAGGCACAAGCTTTAGGACG |