| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.153666 |
| Chromosome: | chromosome 16 |
| Location: | 2733392 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g662650 | NAT36 | N-acetyltransferase; (1 of 1) 2.3.1.82 - Aminoglycoside 6'-N-acetyltransferase / Kanamycin 6'-N-acetyltransferase | 3'UTR_intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GTTCGAAGCGCGTGGGGGCCCCTTCCGTTG |
| Internal bar code: | TGAGAGCGCGTGTTACGACGAC |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 932 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 1106 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 17 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | AGATCTAACGCTCGCCACAT |
| Suggested primer 2: | GAGGCTTGAAAAAGTGCAGG |