| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.153720 |
| Chromosome: | chromosome 16 |
| Location: | 4937653 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre16.g685450 | DHC8 | Axonemal Dynein Heavy Chain 8; (1 of 3) PTHR10676//PTHR10676:SF242 - DYNEIN HEAVY CHAIN FAMILY PROTEIN // DYNEIN HEAVY CHAIN 3, AXONEMAL | intron |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | CCGCCCCCCGCGCTCCCTCGCCTTCCCCGC |
| Internal bar code: | ATCTAGAGGTGATACGATGACT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 593 |
| LEAP-Seq percent confirming: | 100.0 |
| LEAP-Seq n confirming: | 81 |
| LEAP-Seq n nonconfirming: | 0 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | CTCCTCCATGTCCACATCCT |
| Suggested primer 2: | ATACGAGTTGCAGTTGCACG |