Insertion cassette: | CIB1 |
Side of cassette: | 5' |
Strand: | + |
Strain: | LMJ.RY0402.153753 |
Chromosome: | chromosome 6 |
Location: | 5555457 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre06.g285300 | SUT1 | Sugar transporter; (1 of 1) K08200 - MFS transporter, OCT family, solute carrier family 22 (organic cation transporter), member 3 (SLC22A3, OCT3) | CDS |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | TCCGGCCAGCGCGGTGCCGCCCCCGATCAC |
Internal bar code: | TTGGACGCAGGGACTTCACTCA |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 659 |
LEAP-Seq percent confirming: | 99.4549 |
LEAP-Seq n confirming: | 4926 |
LEAP-Seq n nonconfirming: | 27 |
LEAP-Seq n unique pos: | 4 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | CTTATCCCCGTCCCATACCT |
Suggested primer 2: | GGTTTCGTCATGTGTTGTCG |