Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | - |
Strain: | LMJ.RY0402.153840 |
Chromosome: | chromosome_6 |
Location: | 8751962 |
Confidence (%): | 95 |
Locus systematic id | Locus common name | Defline | Orientation | Feature |
---|---|---|---|---|
Cre06.g309900 | MST2 | Predicted protein with sequence similarity to mastigoneme protei | sense | CDS |
Insertion site details | |
Flanking sequence (orientation from cassette outwards): | CTGTCTTGAACAAGCCTTTGCCTTCAGGTG |
Internal bar code: | CCGAGGTCGCCTCCAGGCTCCT |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 622 |
LEAP-Seq percent confirming: | 97.9855 |
LEAP-Seq n confirming: | 1751 |
LEAP-Seq n nonconfirming: | 36 |
LEAP-Seq n unique pos: | 11 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | GCAAGCCCTGCTCAGTTTAC |
Suggested primer 2: | CAAGAGCAGGACCCAGTAGC |