| Insertion cassette: | CIB1 |
| Side of cassette: | 5' |
| Strand: | - |
| Strain: | LMJ.RY0402.153840 |
| Chromosome: | chromosome_6 |
| Location: | 8752022 |
| Confidence (%): | 95 |
| Locus systematic id | Locus common name | Defline | Orientation | Feature |
|---|---|---|---|---|
| Cre06.g309900 | MST2 | Predicted protein with sequence similarity to mastigoneme protei | sense | CDS |
Insertion site details | |
| Flanking sequence (orientation from cassette outwards): | GCGCCAGCGCCAGAGGAAAGGCTGGGCGAG |
| Internal bar code: | TTTTTCGGCTCGCGATAACTAG |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 222 |
| LEAP-Seq percent confirming: | 99.8341 |
| LEAP-Seq n confirming: | 6018 |
| LEAP-Seq n nonconfirming: | 10 |
| LEAP-Seq n unique pos: | 3 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GCAAGCCCTGCTCAGTTTAC |
| Suggested primer 2: | CAAGAGCAGGACCCAGTAGC |