| Insertion cassette: | CIB1 |
| Side of cassette: | 3' |
| Strand: | - |
| Strain: | LMJ.RY0402.154006 |
| Chromosome: | chromosome 14 |
| Location: | 3588664 |
| Confidence (%): | 73 |
| Locus systematic id | Locus common name | Defline | Feature |
|---|---|---|---|
| Cre14.g631145 | (1 of 2) IPR002889//IPR008979 - Carbohydrate-binding WSC // Galactose-binding domain-like | 5'UTR |
Insertion site details | |
| Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GGCGCTCAGTCTAAGTTTGCAGTCAACGCC |
| Internal bar code: | GAGGGCGGCCGAGCGATCGCGT |
Confirmation - LEAP-Seq | |
| LEAP-Seq distance: | 201 |
| LEAP-Seq percent confirming: | 68.6747 |
| LEAP-Seq n confirming: | 1083 |
| LEAP-Seq n nonconfirming: | 494 |
| LEAP-Seq n unique pos: | 7 |
Suggested primers for confirmation by PCR | |
| Suggested primer 1: | GGCAAAGAAGACGTAGGCTG |
| Suggested primer 2: | CAAAAATGTGTCAACGACGG |