Insertion cassette: | CIB1 |
Side of cassette: | 3' |
Strand: | + |
Strain: | LMJ.RY0402.154025 |
Chromosome: | chromosome 2 |
Location: | 7197066 |
Confidence (%): | 58 |
Locus systematic id | Locus common name | Defline | Feature |
---|---|---|---|
Cre02.g146200 | (1 of 89) PF00076 - RNA recognition motif. (a.k.a. RRM, RBD, or RNP domain) (RRM_1) | 3'UTR |
Insertion site details | |
Expected flanking sequence (starting at cassette; orientation from cassette outwards): | GCCGACCGCTACCAGCGGTATCACGCCAGT |
Internal bar code: | ATCTCGCAGCGAAGGTGGCCCG |
Confirmation - LEAP-Seq | |
LEAP-Seq distance: | 133 |
LEAP-Seq percent confirming: | 93.5484 |
LEAP-Seq n confirming: | 696 |
LEAP-Seq n nonconfirming: | 48 |
LEAP-Seq n unique pos: | 2 |
Suggested primers for confirmation by PCR | |
Suggested primer 1: | AACAATGCAGTTATGCAGCG |
Suggested primer 2: | AGAAGGCGGAGAAGGAGAAG |