Insertion junction: LMJ.RY0402.154077_1

Overview

Insertion cassette:CIB1
Side of cassette:3'
Strand:+
Strain:LMJ.RY0402.154077
Chromosome:chromosome_10
Location:2320191
Confidence (%):73
Locus systematic id Locus common name Defline Orientation Feature
Cre10.g434800 antisense intron

Insertion site details

Flanking sequence (orientation from cassette outwards):AGCGGTGTGAATGACATGGACAGAACGCAA
Internal bar code:ATGCGCTCGTTCTGCCACGGAG

Confirmation - LEAP-Seq

LEAP-Seq distance:512
LEAP-Seq percent confirming:84.5259
LEAP-Seq n confirming:1453
LEAP-Seq n nonconfirming:266
LEAP-Seq n unique pos:9

Suggested primers for confirmation by PCR

Suggested primer 1:ATCCTAACCCGCACAGTGTC
Suggested primer 2:TACCTTTCCCATCTTGCCTG